Noninvasive Diagnostic Technique for Nonalcoholic Fatty Liver Disease Based on Features of Tongue Images / 中国结合医学杂志

OBJECTIVE@#To investigate a new noninvasive diagnostic model for nonalcoholic fatty liver disease (NAFLD) based on features of tongue images.@*METHODS@#Healthy controls and volunteers confirmed to have NAFLD by liver ultrasound were recruited from China-Japan Friendship Hospital between September 2018 and May 2019, then the anthropometric indexes and sampled tongue images were measured. The tongue images were labeled by features, based on a brief protocol, without knowing any other clinical data, after a series of corrections and data cleaning. The algorithm was trained on images using labels and several anthropometric indexes for inputs, utilizing machine learning technology. Finally, a logistic regression algorithm and a decision tree model were constructed as 2 diagnostic models for NAFLD.@*RESULTS@#A total of 720 subjects were enrolled in this study, including 432 patients with NAFLD and 288 healthy volunteers. Of them, 482 were randomly allocated into the training set and 238 into the validation set. The diagnostic model based on logistic regression exhibited excellent performance: in validation set, it achieved an accuracy of 86.98%, sensitivity of 91.43%, and specificity of 80.61%; with an area under the curve (AUC) of 0.93 [95% confidence interval (CI) 0.68-0.98]. The decision tree model achieved an accuracy of 81.09%, sensitivity of 91.43%, and specificity of 66.33%; with an AUC of 0.89 (95% CI 0.66-0.92) in validation set.@*CONCLUSIONS@#The features of tongue images were associated with NAFLD. Both the 2 diagnostic models, which would be convenient, noninvasive, lightweight, rapid, and inexpensive technical references for early screening, can accurately distinguish NAFLD and are worth further study.

Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Mechanism of salvianolic acid B protecting H9C2 from OGD/R injury based on mitochondrial fission and fusion / 药学学报

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

Possible mechanisms of toxic effects of per-and polyfluoroalkyl substances exposure on thyroid / 环境与职业医学

Per- and polyfluoroalkyl substances (PFASs) are persistent organic pollutants (POPs). They are widely used in food packaging, tableware coating, stain resistant furniture, and other industrial production. Humans are exposed to PFASs on a daily basis through drinking water and intaking food, use of consumer products containing PFASs, and occupational exposure during the production of PFASs or related products. A growing body of toxicological studies has shown that PFASs exposure disrupts the thyroid hormone (TH) system and causes hypothyroidism, which is further supported by population epidemiological studies. PFASs can damage thyroid follicular cells and sodium/iodine transporters to impair iodine uptake by thyroid cells. They interfere with the synthesis of thyroglobulin, reduce the activity of thyroid peroxidase, and affect the synthesis and secretion of TH. They interfere with TH transportation and biological effects via TH competitive binding thyroid transporter or thyroid hormone receptor. They suppress TH signaling pathway and deiodinase activity, interfere negative feedback mechanism, and accelerate TH metabolism and excretion. The processes of TH synthesis, transport, degradation, and biological effects may all be affected by PFASs exposure. This paper described possible toxic mechanisms of PFASs on the thyroid from four aspects: TH biosynthesis, transport, action on target cells, and metabolic excretion stage, and summarized the thyroid toxicity associated with PFASs exposure.

The rules of acupoint selection of acupuncture and moxibustion for scrofula in ancient times / 中国针灸

Based on data mining technology, the rules of acupoint selection of acupuncture-moxibustion for scrofula in ancient times were analyzed. The relevant articles of acupuncture and moxibustion for scrofula were searched in the Chinese Medical Code, and the original article, acupoint name, acupoint characteristic, and acupoint meridian tropism, etc. were screened and extracted. The Microsoft Excel 2019 was used to establish a acupoint prescription database, and the frequency of acupoints as well as their meridian tropism and characteristics were analyzed. The SPSS21.0 was applied to perform cluster analysis of acupuncture prescriptions; the SPSS Modeler 18.0 was used to perform the association rules analysis of the neck and the chest-armpit acupoints, respectively. As a result, 314 acupuncture prescriptions were extracted, including 236 single-acupoint prescriptions and 78 multiple-acupoints prescriptions (53 for neck and 25 for chest-armpit). A total of 54 acupoints were involved, with a total frequency of 530. The top 3 commonly-used acupoints were Tianjing (TE 10), Zulinqi (GB 41) and Taichong (LR 3); the most commonly-used meridians were hand shaoyang meridian, foot shaoyang meridian, hand yangming meridian and foot yangming meridian; the most commonly-used special acupoints were he-sea points and shu-stream points. The cluster analysis obtained 6 clusters, and the association rule analysis obtained that the core prescriptions of the neck were Quchi (LI 11), Jianyu (LI 15), Tianjing (TE 10) and Jianjing (GB 21), while the core prescriptions of the chest-armpit were Daling (PC 7), Yanglingquan (GB 34), Danzhong (CV 17), Jianjing (GB 21), Waiguan (TE 5), Zhigou (TE 6), Yuanye (GB 22) and Zhangmen (LR 13). The core prescriptions obtained from association rule analysis by difference areas were basically consistent with those by cluster analysis of total prescriptions.

Neonatal systemic pseudohypoaldosteronism type I / 中国当代儿科杂志

An 18-day-old male infant was admitted to the hospital due to recurrent hyperkalemia for more than 10 days. The neonate had milk refusal and dyspnea. The blood gas analysis revealed recurrent hyperkalemia, hyponatremia and metabolic acidosis. Adrenocortical hormone replacement therapy was ineffective. Additional tests showed a significant increase in aldosterone levels. Family whole exome sequencing revealed that the infant had compound heterozygous in the SCNNIA gene, inherited from both parents. The infant was diagnosed with neonatal systemic pseudohypoaldosteronism type I. The infant's electrolyte levels were stabilized through treatment with sodium polystyrene sulfonate and sodium supplement. The infant was discharged upon clinical recovery. This study provides a focused description of differential diagnosis of salt-losing syndrome in infants and introduces the multidisciplinary management of neonatal systemic pseudohypoaldosteronism type I.

Effect of procalcitonin on lipopolysaccharide-induced expression of nucleotide-binding oligomerization domain-like receptor protein 3 and caspase-1 in human umbilical vein endothelial cells / 中国当代儿科杂志

OBJECTIVES@#To study the effect of procalcitonin (PCT) on lipopolysaccharide (LPS)-induced expression of the pyroptosis-related proteins nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) and caspase-1 in human umbilical vein endothelial cells (HUVECs).@*METHODS@#HUVECs were induced by LPS to establish a model of sepsis-induced inflammatory endothelial cell injury. The experiment was divided into two parts. In the first part, HUVECs were randomly divided into four groups: normal control, LPS (1 μg/mL), PCT (10 ng/mL), and LPS+PCT (n=3 each). In the second part, HUVECs were randomly grouped: normal control, LPS, and LPS+PCT of different concentrations (0.1, 1, 10, and 100 ng/mL) (n=3 each). Quantitative real-time PCR and Western blot were used to measure the mRNA and protein expression levels of NLRP3 and caspase-1 in each group.@*RESULTS@#In the first experiment: compared with the normal control group, the PCT, LPS, and LPS+PCT groups had significantly upregulated mRNA and protein expression levels of NLRP3 and caspase-1 (P<0.05); compared with the LPS group, the LPS+PCT group had significantly downregulated mRNA and protein expression levels of NLRP3 and caspase-1 (P<0.05). In the second experiment: compared with those in the LPS group, the mRNA and protein expression levels of NLRP3 and caspase-1 in the LPS+PCT of different concentrations groups were significantly downregulated in a concentration-dependent manner (P<0.05).@*CONCLUSIONS@#LPS can promote the expression of the pyroptosis-related proteins NLRP3 and caspase-1 in HUVECs, while PCT can inhibit the LPS-induced expression of the pyroptosis-related proteins NLRP3 and caspase-1 in HUVECs in a concentration-dependent manner.

Antithrombin deficiency caused by SERPINC1 gene mutations predispose to venous thrombotic events / 中华检验医学杂志

Objective:To analyze 12 antithrombins (AT) gene mutations that cause AT deficiency and discuss the relationship between the SERPINC1 gene. mutations and venous thrombotic events.Methods:This study belongs to case series of observational studies. Collected the clinical data of 12 AT deficiency cases in the First Affiliated Hospital of Wenzhou Medical University from April 2014 to April 2021 and collected the blood samples before treatment. The AT activity (AT: A) and AT antigen (AT: Ag) was detected by chromogenic substrate and immunoturbidimetry, respectively. The 7 exons and flanking sequences of the SERPINC1 gene were sequenced directly by PCR, the suspected mutations were validated by reverse sequencing. Analyzed the correlation between the SERPINC1 gene. mutations and venous thrombotic events and figured out the proportion.Results:The AT: A of the 12 patients all decreased significantly, ranging from 30% to 66%, and the AT: Ag of the 7 patients decreased accordingly, showing type Ⅰ AT deficiency, and the AT: Ag of the other 5 patients were normal, presented type Ⅱ AT deficiency. 12 mutations were found including 6 heterozygous mutations which were discovered for the first time: c.456_458delCTT(p.phe121del), c.318_319insT(p.Asn75stop), c.922G>T(p.Gly276Cys), c.938T>C (p.Met281Thr), c.1346T>A(p.Leu417Gln)and c.851T>C(p.Met252Thr). All 12 patients had venous thrombosis, and 3 cases including 2 compound heterozygotes and 1 single heterozygote all suffered from deep venous thrombosis (DVT) when they were younger without obvious triggers. The other 9 patients all combined with the other thrombotic factors including old age, hypertensive, smoking, pregnancy, and prolonged immobilization.Conclusion:Patients with AT deficiency caused by SERPINC1 gene defects are prone to venous thrombosis, especially combined with other thrombotic factors.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Endovascular treatment of ruptured lobulated anterior communicating artery aneurysms: A retrospective case series study of 24 patients / 国际脑血管病杂志

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

Risk Factors of Hypogonadism in Male Patients with Hyperuricemia in Xinjiang / 中山大学学报(医学科学版)

ObjectiveTo explore the risk factors of hypogonadism in male hyperuricemia （HUA） patients in Xinjiang. MethodsClinical data of 217 male patients with HUA admitted to the Department of Endocrinology and Metabolism of the People's Hospital of Xinjiang Uygur Autonomous Region from June 2021 to December 2022 were collected. Patients meeting the diagnostic criteria for hypogonadism were included in the case group （98 cases）， and patients with normal gonadism were included in the control group （119 cases）. The differences of different metabolic indexes between the two groups and the correlation of male hypogonadism were analyzed. ResultsCompared with those in normal gonadal function group， in hypogonadism group， age， waist circumference （WC）， body mass index （BMI）， the levels of fasting blood glucose （FPG）， fasting insulin （FINS）， insulin resistance index assessed by homeostasis model （HOMA-IR）， alanine aminotransferase （ALT）， blood uric acid （SUA） and sex hormone binding globulin （SHBG） were significantly increased； the levels of γ-glutamyltransferase （GGT）， 25-hydroxyvitamin D ［25（OH）D］， progesterone （P）， estradiol （E2）， dehydroepiandrosterone （DHEA） and serum free triiodothyronine （FT3） were significantly decreased （P < 0.05）； and the proportion of patients with obesity （OB）， non-alcoholic fatty liver （NAFLD）， hyperlipidemia （HLP）， hypertension （HBP）， coronary heart disease （CHD） and use of angiotensin receptor antagonist （ARB） and aspirin was significantly increased （P < 0.05）. Correlation analyses showed that free testosterone （FT） was negatively correlated with age， WC， BMI， FPG， FINS， HOMA-IR， SUA， SHBG and ALT， but positively correlated with 25（OH）D， P， E2， DHEA and FT3 （P < 0.05）. Logistic regression analysis showed that age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC were independent risk factors for hypogonadism （P < 0.05）. After multivariate adjustment， SUA remained an independent risk factor for hypogonadism ［OR = 1.009， 95%CI （1.004， 1.015）， P = 0.001］. ConclusionsMale HUA patients are often accompanied with hypogonadism. Age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC are independent risk factors of hypogonadism.

Efficiency and safety analysis of Plerixafor combined with granulocyte colony-stimulating factor on autologous hematopoietic stem cell mobilization in lymphoma / 中华血液学杂志

Objective: To evaluate the advantages and safety of Plerixafor in combination with granulocyte colony-stimulating factor (G-CSF) in autologous hematopoietic stem cell mobilization of lymphoma. Methods: Lymphoma patients who received autologous hematopoietic stem cell mobilization with Plerixafor in combination with G-CSF or G-CSF alone were obtained. The clinical data, the success rate of stem cell collection, hematopoietic reconstitution, and treatment-related adverse reactions between the two groups were evaluated retrospectively. Results: A total of 184 lymphoma patients were included in this analysis, including 115 cases of diffuse large B-cell lymphoma (62.5%) , 16 cases of classical Hodgkin's lymphoma (8.7%) , 11 cases of follicular non-Hodgkin's lymphoma (6.0%) , 10 cases of angioimmunoblastic T-cell lymphoma (5.4%) , 6 cases of mantle cell lymphoma (3.3%) , and 6 cases of anaplastic large cell lymphoma (3.3%) , 6 cases of NK/T-cell lymphoma (3.3%) , 4 cases of Burkitt's lymphoma (2.2%) , 8 cases of other types of B-cell lymphoma (4.3%) , and 2 cases of other types of T-cell lymphoma (1.1%) ; 31 patients had received radiotherapy (16.8%) . The patients in the two groups were recruited with Plerixafor in combination with G-CSF or G-CSF alone. The baseline clinical characteristics of the two groups were basically similar. The patients in the Plerixafor in combination with the G-CSF mobilization group were older, and the number of recurrences and third-line chemotherapy was higher. 100 patients were mobilized with G-CSF alone. The success rate of the collection was 74.0% for one day and 89.0% for two days. 84 patients in the group of Plerixafor combined with G-CSF were recruited successfully with 85.7% for one day and 97.6% for two days. The success rate of mobilization in the group of Plerixafor combined with G-CSF was substantially higher than that in the group of G-CSF alone (P=0.023) . The median number of CD34(+) cells obtained in the mobilization group of Plerixafor combined with G-CSF was 3.9×10(6)/kg. The median number of CD34(+) cells obtained in the G-CSF Mobilization group alone was 3.2×10(6)/kg. The number of CD34(+) cells collected by Plerixafor combined with G-CSF was considerably higher than that in G-CSF alone (P=0.001) . The prevalent adverse reactions in the group of Plerixafor combined with G-CSF were grade 1-2 gastrointestinal reactions (31.2%) and local skin redness (2.4%) . Conclusion: The success rate of autologous hematopoietic stem cell mobilization in lymphoma patients treated with Plerixafor combined with G-CSF is significantly high. The success rate of collection and the absolute count of CD34(+) stem cells were substantially higher than those in the group treated with G-CSF alone. Even in older patients, second-line collection, recurrence, or multiple chemotherapies, the combined mobilization method also has a high success rate of mobilization.

Treatment of neovascular glaucoma by anti-vascular endothelial growth factor combined with ultrasonic ciliary plasty / 国际眼科杂志(Guoji Yanke Zazhi)

AIM: To investigate the clinical efficacy and safety of ultrasonic ciliary plasty(UCP)combined with injection of anti-vascular endothelial growth factor(VEGF)in the treatment of neovascular glaucoma(NVG).METHODS: A total of 30 NVG patients(30 eyes)admitted to the First Affiliated Hospital of Bengbu Medical College from September 2020 to September 2021 were selected. After admission, all the eyes of the patients were injected with anti-VEGF drug(ranibizumab). After surgery, 15 patients were randomly selected for UCP treatment(UCP group), and the other 15 patients received trabeculectomy(trabeculectomy group). During the 10mo postoperative follow-up, the decrease of intraocular pressure was compared between the two groups and the changes of the degree of ocular pain and the occurrence of related complications were evaluated at each follow-up visit.RESULTS: The intraocular pressure and pain degree of the UCP and trabeculectomy groups were significantly lower than those before operation, and the complication probability of the UCP group was less than that of the trabeculectomy group.CONCLUSION: With fewer complications and high safety, UCP combined with anti-VEGF injection can effectively control intraocular pressure and pain in NVG patients.

Recent advances in small molecule inhibitors of interleukin‑1 receptor-associated kinase / 药学学报

Interleukin-1 receptor associated kinase 4 (IRAK-4), acting as a serine threonine kinase, is considered as a key signal node for the transduction of IL-1R family and TLRs signal pathway. Studies have found that IRAK-4 has a hand in many signal pathways, involving the inflammatory response of human joints, intestines, liver and nervous system, as well as other autoimmune diseases. It is also one of the causes of drug resistance of some cancer cells. Therefore, IRAK-4 tends to be an effective therapeutic target for inflammatory diseases and cancer. The prospects for the development of drugs in this pathway is to develop novel IRAK-4 small molecule inhibitors and investigate their safety and effectiveness, enrich the clinical treatment of inflammatory and cancer diseases finally. This paper classified and summarized the latest research progress on small molecule inhibitors of IRAK-4 signaling pathway according to structures of the compounds, in order to provide assistances and references for the research and development of related drugs.

T cell receptor-based immunotherapy: a review / 生物工程学报

T cells play central roles in anti-tumor immune responses. Immune checkpoint therapy, which is based on modulation of T cell reactivity, has achieved breakthrough in clinical treatment of multiple tumors. Moreover, adoptive T cell therapy, which includes mainly genetically engineered T cells, has shown substantial treatment efficacy in hematoma. Immune therapy has tremendously changed the scenario of clinical tumor treatment and become critical strategies for treating multiple tumors. T cell receptor (TCR) is the fundamental molecule responsible for the specificity of T cell recognition. TCRs could recognize peptides, which are derived from intracellular or extracellular tumor antigens, presented by major histocompatibility complex (MHC) and are therefore highly sensitive to low antigen level. Thereby, TCRs are broadly recognized as promising molecules for the development of anti-tumor drugs. The approval of the first TCR drug in 2022 has initiated a new era for TCR-based therapeutics and since then, multiple TCR drugs have shown substantial treatment efficacy in multiple tumors. This review summarizes the progress of TCR-based immune therapeutic strategies, including T cell receptor-engineered T cell (TCR-T), TCR-based protein drugs, and other cell therapies based on TCR signaling, providing useful information for future design of immune therapeutics based on TCR.

Betulinic Acid Improves Cardiac Function in Septic Rats Through AKT / mTOR and AKT / AMPK -modulated Autophagy / 中国生物化学与分子生物学报

Betulinic acid (BA) exerts protective effects on organs in septic animals. However, whether BA can improve cardiac function in sepsis and the underlying mechanism remain unclear. Here, male Sprague-Dawley rats were pretreated with BA (25 mg/ kg/ d, i. g.) for 5 days and then intraperitoneally injected with lipopolysaccharide (LPS, 10 mg/ kg). The rats were anesthetized to determine transthoracic echocardiography using a high-resolution imaging system for small animals after they were treated with LPS for 6 h. Histopathologic alterations were examined by HE staining. Myocardial injury markers (cTnI and CK-MB) and inflammatory factors (TNF-α, IL-1β and IL-6) in the serum were measured by the enzyme-linked immunosorbent assay. Autophagy-related proteins (p62 and LC3 Ⅱ) and AKT-modulated autophagy pathways in the myocardium were determined by Western blotting. Pretreatment with BA markedly improved left ventricular ejection fraction (EF) and fraction shortening (FS) (P<0. 05), improved myocardial histomorphology, and significantly inhibited cTnI, CK-MB, TNF-α, IL-1β and IL-6 (P<0. 05) in the septic rat serum. BA markedly decreased p62 (P<0. 01), increased LC3 Ⅱ (P< 0. 001), and significantly down-regulated p-AKT (Thr308), p-AMPKα (Ser485/ 491), p-mTOR (Ser2448) and p-S6K (Thr389) (P<0. 05), while markedly up-regulated p-AMPKα (Thr172) and pULK1 (Ser317) (P<0. 01) in septic rat hearts. The findings indicate that BA can attenuate sepsis-induced myocardial dysfunctions associated with down-regulating autophagy inhibiting pathways mediated by AKT/ mTOR and AKT/ AMPK pathways.

ADAR1 regulates vascular remodeling in hypoxic pulmonary hypertension through N1-methyladenosine modification of circCDK17

Pulmonary hypertension (PH) is an extremely malignant pulmonary vascular disease of unknown etiology. ADAR1 is an RNA editing enzyme that converts adenosine in RNA to inosine, thereby affecting RNA expression. However, the role of ADAR1 in PH development remains unclear. In the present study, we investigated the biological role and molecular mechanism of ADAR1 in PH pulmonary vascular remodeling. Overexpression of ADAR1 aggravated PH progression and promoted the proliferation of pulmonary artery smooth muscle cells (PASMCs). Conversely, inhibition of ADAR1 produced opposite effects. High-throughput whole transcriptome sequencing showed that ADAR1 was an important regulator of circRNAs in PH. CircCDK17 level was significantly lowered in the serum of PH patients. The effects of ADAR1 on cell cycle progression and proliferation were mediated by circCDK17. ADAR1 affects the stability of circCDK17 by mediating A-to-I modification at the A5 and A293 sites of circCDK17 to prevent it from m1A modification. We demonstrate for the first time that ADAR1 contributes to the PH development, at least partially, through m1A modification of circCDK17 and the subsequent PASMCs proliferation. Our study provides a novel therapeutic strategy for treatment of PH and the evidence for circCDK17 as a potential novel marker for the diagnosis of this disease.

Genetic analysis of a Chinese pedigree with 6q26q27 microduplication and 15q26.3 microdeletion / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for a Chinese pedigree with 6q26q27 microduplication and 15q26.3 microdeletion.@*METHODS@#A fetus with a 6q26q27 microduplication and a 15q26.3 microdeletion diagnosed at the First Affiliated Hospital of Wenzhou Medical University in January 2021 and members of its pedigree were selected as the study subject. Clinical data of the fetus was collected. The fetus and its parents were analyzed by G-banding karyotyping and chromosomal microarray analysis (CMA), and its maternal grandparents were also subjected to G-banding karyotype analysis.@*RESULTS@#Prenatal ultrasound had indicated intrauterine growth retardation of the fetus, though no karyotypic abnormality was found with the amniotic fluid sample and blood samples from its pedigree members. CMA revealed that the fetus has carried a 6.6 Mb microduplication in 6q26q27 and a 1.9 Mb microdeletion in 15q26.3, and his mother also carried a 6.49 duplication and a 1.867 deletion in the same region. No anomaly was found with its father.@*CONCLUSION@#The 6q26q27 microduplication and 15q26.3 microdeletion probably underlay the intrauterine growth retardation in this fetus.

Traditional application and modern research progress on new foreign medicinal resources / 中国中药杂志

Chinese medicinal resources are the material basis for the survival and development of traditional Chinese medicine(TCM)and the sustainable development of Chinese medicinal resources is also an important project for the modernization of TCM in China. With the increasing demand for Chinese medicinal resources in China, over-exploitation has destroyed Chinese medicinal resources, resulting in a shortage of many natural medicinal resources in China and making the sustainable development of TCM in trouble. The introduced new foreign medicinal resources have become effective supplement and replacement for Chinese medicinal resources to some extent. However, the development and utilization of new foreign medicinal resources in China are different. To fully understand the development of new foreign medicinal resources in China, this paper, taking 43 new foreign medicinal resources such as Acacia nilotica as objects, sorted out the introduction forms and policies of new foreign medicinal resources, overviewed its current development status in China, summarized the application experience of new foreign medicinal resources in the place of origin, as well as the research progress and problems of new foreign medicinal resources in China and abroad, and analyzed the research situation, which can enrich Chinese medicinal resources and other uses, promote the sustainable development of Chinese medicinal resources, and provide ideas for further development and research of new foreign medicinal resources.

Effects of stereoscopic traction on photosynthetic characteristics, yield, and quality of Codonopsis pilosula under organic cultivation / 中国中药杂志

To solve the serious problem of stem and leaf shading in the middle and late stage of traditional flat planting of Codonopsis pilosula, this study analyzed the effects of different stereoscopic traction heights on the photosynthetic characteristics and growth of C. pilosula and explored the optimal traction height to improve the yield and quality of C. pilosula. The experiment designed three stereo-scopic traction heights [H1(60 cm), H2(90 cm), and H3(120 cm)] with natural growth without traction as the control(CK). The results showed that the increase in stereoscopic traction heights broadened the growth space of stems and leaves of C. pilosula, enhanced the ventilation effect, significantly increased the average daily net photosynthetic rate of C. pilosula, promoted the absorption of intercellular CO_2, decreased the transpiration rate, and reduced the evaporation of water. Moreover, it effectively avoided the problem of weakened photosynthesis, maintained the carbon balance of individual plants, and promoted the growth and development of the C. pilosula roots. In terms of the seed yield of C. pilosula, it was ranked as H2>H1>H3>CK. To be specific, H1 increased by 213.41% compared with CK, H2 increased by 282.43% compared with CK, and H3 increased by 133.95% compared with CK. The yield and quality of C. pilosula were the highest in the H3 treatment group, with the fresh yield of 6 858.33 kg·hm~(-2), 50.59% higher than CK, dry yield of 2 398.33 kg·hm~(-2), 76.54% higher than CK, and lobetyolin content of 0.56 mg·g~(-1), 45.22% higher than CK. Therefore, the stereoscopic traction height has a great influence on the photosynthetic characteristics, yield, and quality of C. pilosula. Particularly, the yield and quality of C. pilosula can be optimized and improved in the traction height treatment of H3(120 cm). This planting method is worth popularizing and applying in the cultivated management of C. pilosula.